BBa_K619889 1 BBa_K619889 prfA-UTR, RNA thermosensor from Listeria monocytogenes 2011-09-25T11:00:00Z 2015-05-08T01:12:54Z The source of the DNA sequence is Listeria monocytogenes prfA-UTR, however we constructed this part by simply ordering DNA oligos and annealing them. This part contains prfA-UTR, an RNA thermosensor from Listeria monocytogenes originally characterized by Johansson et al. Cell 110:551561. The secondary structure of this RNA forms at hairpin at 30'C which masks the ribosomal binding site and initiating ATG. At 37'C this hairpin melts allowing ribosomes to bind and translation to proceed. Be sure that your gene fusion is in frame since the initiating ATG for translation is encoded in this DNA (see diagram from paper). Sequence just before initiating ATG is GAGACATG where the ATG in this sequence is the initiating ATG. false true _791_ 0 8978 9 It's complicated false false Julianne Grose annotation2146685 1 rbs range2146685 1 113 118 annotation2146686 1 start range2146686 1 125 127 BBa_K619889_sequence 1 tgcagtttagcgtgcggctgcagtttagcgtgactttctttcaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattggaggatgagacatgaacgctcaaaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z