BBa_K619890 1 BBa_K619890 mutated prfA thermosensor from listeria 2011-09-26T11:00:00Z 2015-05-08T01:12:54Z This is the prfA-UTR from Listeria monocytogenes. This is the prfA-UTR from Listeria monocytogenes which has been randomly mutated to produce a thermosensor this a more discrete dynamic range. In contrast to the our wild type thermosensor (part BBa_K619889) which activates translation from a 30 to 37 degree shift, this thermosensor activates transcription from a 35 to 37 degree shift. This mutation was isolated by randomly mutagenizing part BBa_K619889 and monitoring a lacZ output. false false _791_ 0 8978 9 It's complicated false see BBa_K619889, the Shine-Delagarno was mutated from GGGGGA to GGAGGA in order to optimize expression in E. coli, otherwise the thermosensor is the original sequence of prfA-UTR from Listeria monocytogenes. false Julianne Grose annotation2144637 1 start range2144637 1 125 127 annotation2144636 1 rbs range2144636 1 113 118 BBa_K619890_sequence 1 tgcagtttagcgtgcggctgcagtttagcgtgactttctttcaacggctaacaatcgttgttactgcctaaagtttttagggtattttaaaaaagggcgataaaaaacgattggaggatgagacatgaacgctcaaaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z