BBa_K619892 1 BBa_K619892 mutated prfA thermosensor from listeria 2011-09-26T11:00:00Z 2015-05-08T01:12:54Z prfA-UTR from Listeria monocytogenes This is the prfA-UTR thermosensor mutated to produce a thermosensor with a less dramatic increase in expression when switching from 30 to 37 degrees. Characterization of its dynamic range is underway. The part was made by TAQ-mediated random mutagenesis of our "wild-type" thermosensor (BBa-19889) and subsequent screening using a lacZ reporter. There are other thermosensors entered into the IGEM database with different dynamic ranges obtained from this screen. To use this thermosensor, be sure to clone in frame with the indicated initiating ATG. false false _791_ 0 8978 9 It's complicated false Our "wild-type" thermosensor (BBa-19889) Shine-Delagarno has been optimized for expression in E. coli. Otherwise, the "wild-type" sequence is identical to the thermosensor sequence from Listeria monocytogenes. false Julianne Grose annotation2144640 1 start range2144640 1 125 127 annotation2144639 1 rbs range2144639 1 113 118 BBa_K619892_sequence 1 tgcagtttagcgtgcggctgcagtttagcgtgactttctttcaacagcttacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattggaggatgagacatgaacgctcaaaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z