BBa_K619894 1 BBa_K619894 mutated prfA-UTR thermosensor from Listeria monocytogenes 2011-09-26T11:00:00Z 2015-05-08T01:12:54Z prfA-UTR from Listeria monocytogenes This is the prfA-UTR thermosensor mutated to produce a thermosensor with a increased expression at both 30 and 37 degress when compared with wild-type. One can still see induction when switching from 30 to 37 degrees. Characterization of its dynamic range is underway. The part was made by TAQ-mediated random mutagenesis of our "wild-type" thermosensor (BBa-19889) and subsequent screening using a lacZ reporter. There are other thermosensors entered into the IGEM database with different dynamic ranges obtained from this screen. To use this thermosensor, be sure to clone in frame with the indicated initiating ATG. false false _791_ 0 8978 9 It's complicated false Our "wild-type" thermosensor (BBa-19889) Shine-Delagarno has been optimized for expression in E. coli. Otherwise, the "wild-type" sequence is identical to the thermosensor sequence from Listeria monocytogenes. false Julianne Grose annotation2144643 1 rbs range2144643 1 113 118 annotation2144644 1 start range2144644 1 125 127 BBa_K619894_sequence 1 tgcagtttagcgtgcggctgcagtttagcgtgactttctttcaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattggaggatgagacatgaacgctcaaaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z