BBa_K619897 1 BBa_K619897 shortened prfA-UTR thermosensor 2011-09-27T11:00:00Z 2015-05-08T01:12:55Z Patterned after prfA-UTR thermosensor from Listeria monocytogenes but produced by designing oligos that would anneal to produce the desired double stranded DNA This is a truncated version of the prfA-UTR thermosensor from Listeria monocytogenes (see part number BBa_K619889 for the full length, E. coli optimized part). false false _791_ 0 8978 9 Not in stock false note the E. coli optimized Shine-Delgarno which is also present in the parent (BBa_K619889) false BYU IGEM team annotation2146031 1 start range2146031 1 61 63 annotation2146037 1 rbs range2146037 1 49 54 BBa_K619897_sequence 1 tttagcgtgactttctttcaacagctaacaattgttgtaaaaacgattggaggatgagacatgaacgctcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z