BBa_K619898 1 BBa_K619898 medium length prfA-UTR thermosensor from Lysteria Monocytogenes 2011-09-27T11:00:00Z 2015-05-08T01:12:55Z This is a truncated prfA-UTR from Listeria monocytogenes made by annealing primers with the desired sequence. This is a truncation of prfA-UTR thermosensor with the middle section of the hairpin removed (see diagram). It does not respond to temperature shifts of 30 to 37 degrees. This is part of a collection of thermosensors where the parent prfA-UTR from Listeria monocytogenes has been mutated (either by design or random mutagenesis). The parent thermosensor is BBa_K619889. false false _791_ 0 8978 9 Not in stock false Our "wild-type" thermosensor (BBa-19889) Shine-Delgarno has been optimized for expression in E. coli. Otherwise, the "wild-type" sequence is identical to the thermosensor sequence from Listeria monocytogenes. false Julianne Grose annotation2146065 1 start range2146065 1 84 86 annotation2146064 1 rbs range2146064 1 72 77 BBa_K619898_sequence 1 tttagcgtgactttctttcaacagctaacaattgttgttactgcctaatgtaagggcgataaaaaacgattggaggatgagacatgaacgctcaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z