BBa_K620000 1 BBa_K620000 DDT Dehydrochlorinase 2011-09-19T11:00:00Z 2015-05-08T01:12:55Z This part was isolated from Anopheles dirus. The team took the amino acid sequence found in the NCBI protein database and used reverse transcribed using codon optimization for E. coli to create the DNA part. Released HQ 2013 Also known as Glutathione S-transferase 1-1, this protein is supposed to degrade DDT, an endocrine disruptor and persistent organic pollutant. false false _792_ 0 9568 9 In stock true The part was assembled through PCR using a set of long oligos. The sequence contains an NdeI site, which made it more difficult to place into a pET11a vector for protein purification and characterization. false Caltech iGEM 2011 annotation2135663 1 double stop codon range2135663 1 628 633 annotation2135664 1 K620000 range2135664 1 1 633 BBa_K620000_sequence 1 atggacttttactatctgccgggctcagctccgtgtcgtgcggtccaaatgacggcagcggcggttggagtggaactgaatttgaaactgaccgatctgatgaaaggtgaacatatgaaaccggagttccttaagctgaacccccagcattgcattcccaccctggtcgacaatggatttgccctgtgggagtctcgtgcgattcagatttatctggcggagaaatatggcaaagatgataaactgtatccgaaagatccacagaaacgtgctgtggttaatcagcggctgtattttgatatgggaaccctgtatcagcgtttcgccgattatcattatccgcagatttttgctaaacaaccggctaatccggaaaacgaaaagaaaatgaaggatgcggtgggatttctgaatacctttctggaaggccaggaatatgctgctggcaatgatttaaccatcgcggatctgagcctggcggcgaccattgcgacctatgaggtggcaggctttgatttcgcgccgtatcctaacgttgcggcttggttcgcgcgttgcaaagcgaatgctcctggatatgcgctgaatcaggctggtgcagatgagtttaaagctaaattcctgagctagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z