BBa_K622005 1 BBa_K622005 sigma 54 promoter 2011-10-01T11:00:00Z 2015-05-08T01:12:55Z We constructed this part of DNA oligo This part codes a sigma 54 promoter. Phosphorylated NtrC and RNA polymerase which is constructed of sigma 54 factor and the other transcription factor activate this promoter. false false _794_ 0 9320 9 In stock false When you use this part, you should ligate several sigma 54 promoter. false Fumitaka Hashiya BBa_K622005_sequence 1 gattgcaccaacatggtgcttaatgtttccattgaagcactatattggtgcaacattcacatcgtggtgcagcccttttgcacgatggtgcgcatgataacgccttttaggggcaatttaaaagttggcacagatttcgctttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z