BBa_K624010 1 BBa_K624010 CHAMP (anti-H1[mms13]) 2011-09-30T11:00:00Z 2015-05-08T01:12:55Z synthetic sequence computer-aided design of competitive inhibitor targeting helix 1 in mms13 false false _796_ 0 9029 9 Not in stock true to fit BioBrick assembly rules false CHIA-CHEN HSU, Shang-Jui Tsai annotation2148612 1 stop range2148612 1 58 60 annotation2148611 1 start range2148611 1 1 3 annotation2148613 1 CHAMP (anti-H1[mms13]) range2148613 1 4 57 BBa_K624010_sequence 1 atgaagaagctgttcgtgctgctgatgttcatcatcgtggccctgctgtggaagaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z