BBa_K624012 1 BBa_K624012 RBS from Pmsp3 2011-10-01T11:00:00Z 2015-05-08T01:12:55Z synthetic DNA predicted RBS site from Pmsp3, the strongest promoter of Magnetospirillum magneticum AMB-1 false false _796_ 0 9029 9 Not in stock false to fit biobrick assembly rules false Shang-Jui Tsai annotation2148845 1 artificial start codon range2148845 1 29 31 annotation2148844 1 rbs (from Pmsp3) range2148844 1 1 28 BBa_K624012_sequence 1 gtccaagccctatgagggagcctttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z