BBa_K624013 1 BBa_K624013 RBS (6 bps truncated) from Pmsp3 2011-10-01T11:00:00Z 2015-05-08T01:12:55Z synthetic DNA RBS from Pmsp3 (the strongest promoter on Magnetospirillum magenticum AMB-1) with the last 6 bps truncated to fit biobrick assembly standards (X-S scar will fill in this gap automatically). false false _796_ 0 9029 9 Not in stock false to fit biobrick assembly rules false Shang-Jui Tsai annotation2148846 1 rbs (trunc.) from Pmsp3 range2148846 1 1 22 BBa_K624013_sequence 1 gtccaagccctatgagggagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z