BBa_K624015 1 BBa_K624015 Pmsp1 2011-10-01T11:00:00Z 2015-05-08T01:12:55Z PCR product from Magnetospirillum magneticum AMB-1 Pmsp1 is the second strongest promoter on Magnteospirillum magneticum AMB-1 false false _796_ 0 9029 9 Not in stock false to fit biobrick assembly standard false Shang-Jui Tsai annotation2148959 1 Pmsp1 range2148959 1 1 194 annotation2148961 1 -35 box range2148961 1 90 95 annotation2149017 1 -10 box range2149017 1 110 118 annotation2148960 1 artificial start codon range2148960 1 195 197 BBa_K624015_sequence 1 gcggtaacgccgcctcgccggtggaagggtgttgtgtggcatccatgccacagtgcggagttttcgatacagccgacgtcccgcctcgcttgactggcggcgcccatcatggcgtgatggcgaccgttcgttcatttggatagcggtcgcggccattgggggtcgttttcgcaaagccaaagagaggagataccatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z