BBa_K624026 1 BBa_K624026 CHAMP-YC 2011-10-03T11:00:00Z 2015-05-08T01:12:55Z CHAMP as synthetic DNA, YC from parts registry inhibitor CHAMP with BRET receptor protein YC (C-fragment of EYFP) fused on its C-terminal false false _796_ 0 9029 9 It's complicated false to fit biobrick assembly standards false Shang-Jui Tsai annotation2151938 1 start range2151938 1 1 3 annotation2151941 1 stop range2151941 1 304 306 annotation2151937 1 BBa_K624010 range2151937 1 1 57 annotation2151939 1 CHAMP (anti-H1[mms13]) range2151939 1 4 57 annotation2151940 1 YC (from EYFP) range2151940 1 58 303 BBa_K624026_sequence 1 atgaagaagctgttcgtgctgctgatgttcatcatcgtggccctgctgtggaagaagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z