BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K624038 1 BBa_K624038 pT7-tetO 2011-10-04T11:00:00Z 2015-05-08T01:12:55Z no. T7 promoter with tet operator. false false _796_ 0 8576 9 Not in stock false no. false Yi-Hong Liou BBa_K624039 1 BBa_K624039 pT7-tetO+RBS 2011-10-04T11:00:00Z 2015-05-08T01:12:55Z no. This part is composed of pT7-tetO and ribosome binding site. false false _796_ 0 8576 9 Not in stock false no. false Yi-Hong Liou component2157773 1 BBa_K624038 component2157775 1 BBa_B0034 annotation2157775 1 BBa_B0034 range2157775 1 31 42 annotation2157773 1 BBa_K624038 range2157773 1 1 22 BBa_K624038_sequence 1 taatacgactcactatgataga BBa_B0034_sequence 1 aaagaggagaaa BBa_K624039_sequence 1 taatacgactcactatgatagatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z