BBa_K625002 1 BBa_K625002 Pu promoter long version with stop codon 2011-09-20T11:00:00Z 2015-05-08T01:12:56Z PCR reaction on plasmid DNA provided by Prof. Sven Panke. pCK04AxylR This is an adapted version of the Pu promoter BBa_I723020. The original design contains the RBS and first 81bp of the XylU. To prevent unwanted fusion proteins from emerging (when this biobrick is cloned without scar), a double stop codon was inserted at the end of the promoter. false false _797_ 0 10153 9 It's complicated false The whole promoter region with all putative regulatory sequences was BioBricked. Stop codons were added in frame with the XylU coding region. false Michael Eichenberger annotation2141890 1 IHF binding site range2141890 1 130 157 annotation2141974 1 XylU range2141974 1 239 319 annotation2141888 1 XylR binding site range2141888 1 37 52 annotation2141889 1 PprA binding site range2141889 1 42 61 annotation2141891 1 -24 range2141891 1 182 188 annotation2141892 1 -12 range2141892 1 193 196 annotation2141915 1 XylR binding site range2141915 1 69 90 annotation2141973 1 xylU start codon range2141973 1 239 241 annotation2141983 1 double stop codon range2141983 1 319 325 BBa_K625002_sequence 1 cccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctatacgagacttaaaataaaaatagtggtgacccttcaatgttgtattttctcaactctgttcagattggttgctttcgccatgtatatcctcaaagcgggccagccgtagccgttacgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z