BBa_K625003 1 BBa_K625003 Pu promoter short version 2011-09-20T11:00:00Z 2015-05-08T01:12:56Z PCR from the plasmid pCK04AxylR provided by Prof Sven Panke Contains a shortened version of BBa_K625002 not containing the RBS and first 81bp of XylU but all necessary elements of the promoter. false false _797_ 0 10153 9 It's complicated false All necessary (Valls et al, 2003) elements of the promoter were kept, whereas the first part of XylU and its RBS were deleted. false Michael Eichenberger annotation2141893 1 -24 range2141893 1 182 188 annotation2141887 1 IHF binding site range2141887 1 130 157 annotation2141914 1 XylR binding site range2141914 1 69 90 annotation2141749 1 XylR binding site range2141749 1 37 52 annotation2141894 1 -12 range2141894 1 193 196 annotation2141750 1 PprA binding site range2141750 1 42 61 BBa_K625003_sequence 1 cccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z