BBa_K627001 1 mdnA mdnA gene encoding the precursor peptide of the tricyclic microviridin 2011-09-20T11:00:00Z 2015-05-08T01:12:56Z The BioBrick mdnA as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843. The BioBrick mdnA is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008). <br><br> Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008). <br><br> The following BioBrick mdnA encodes the ribosomal precursor peptide (MdnA), which is essential for microviridin production (Ziemert et al., 2008). <br><br> Because this BioBrick is an expression part, the adenin of mdnB gene start codon is part of the XbaI recognition site. false false _799_ 0 10585 9 In stock false This BioBrick was built by PCR using the following PCR primers<br> Forward primer: TTCCATGGCGCCAGAGGAATCTAGATGGCATATCCCAACGATC <br> Reverse primer: CTTCTGACTGGGAAGATTATACCGGTTAATACTAGTAGCGGCCGCTGCAGGACGTC<br> To insert mdnA in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI. false iGEM11 Potsdam_Bioware annotation2136227 1 stop range2136227 1 156 158 annotation2136228 1 start range2136228 1 1 2 annotation2136226 1 mdnA range2136226 1 1 149 BBa_K627001_sequence 1 tggcatatcccaacgatcaacaaggtaaagcacttcctttctttgctcgtttcttgtccgtaagcaaagaggaatcttccatcaagtctccttcccctgagcctacctacgggggcacctttaaatacccttctgactgggaagattataccggttaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z