BBa_K627002 1 mdnB ATP-grasp-type ligase from mdn-cluster 2011-09-20T11:00:00Z 2015-05-08T01:12:56Z The BioBrick mdnB as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843. The BioBrick mdnB is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008). <br><br> Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008). <br><br> The following BioBrick mdnB encodes a ATP-grasp-type ligase (Ziemert et al., 2008). <br><br> Because this BioBrick is a RFC10 expression part, the adenine of mdnB gene start codon is part of the XbaI recognition site. false false _799_ 0 10585 9 It's complicated false This BioBrick was built by PCR using the following PCR primers<br> Forward primer: ATTATGAATTCGCGGCCGCTTCTAGATGAAAGAATCGCCTAAAGTTG<br> Reverse primer: TAATCTGCAGCGGCCGCTACTAGTATCAACCGAAGACTAAAAAATCAGCG<br> To insert mdnB in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.<br> <br> Because this BioBrick is a RFC10 expression part, the adenine of mdnB gene start codon is part of the XbaI recognition site. false iGEM11 Potsdam_Bioware annotation2136229 1 mdnB range2136229 1 1 980 annotation2136260 1 stop range2136260 1 978 980 annotation2136259 1 start range2136259 1 1 2 BBa_K627002_sequence 1 tgaaagaatcgcctaaagttgttttattgttgacccatagcggcgattttttcacgattgaccgcgtggctgaggcgatagaaaaaaaaggagccacaccttttcgcttagataccgataaatttcccttagaggttcaattagcagcccaatttaatgggaaaaaaagtttttatcaattaacctataaccatcaatctattgatagtgaacaggtgcaatctgtttggacaagacgtatttggcaacctgaaataacagcggatttagatcctcagtttcgggaggcttgtgtgcgagaatcccagacgactttggctagtttttgggatagtttaaggtcagcgcgttggttagataatttagcgcaaattgagagggctaaaaataagttattacaacttcgtttggcctcagaagttggcttgattatcccccccactttagttaccaataatcctgatgctgcccgggagtttttttcccaggttcagggaagaatggtgagtaaattgttaactgcgatcgccagaagtatggagtcgccggaattttttctttataccagtagggtgaaagcagaagaccttgagggagcggaatcttcacgctattgtcctatggtttttcaagcggaaattcccaaacaattagaattgagagttgtcgtggttaatggacagacatttgtgggagctttagaatcttctcagtataataattctgccgtagattggcgaagaccgggtattgatccgggtgcttggcaacatcatactttacctgattcactattgcagcaacttcagatttttatggctaatttagggttgaattttggggcgtttgattttatcttaactcctgggggagaatacgtttttttagaagttaatccgggtggtgagtggggaatgttagaacgggatttagatttacctatttctaatgcgatcgctgattttttagtcttcggttgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z