BBa_K629001 1 recAp recAp, could be started with exposure to irradiation, UV, nalidixic acid 2011-10-02T11:00:00Z 2015-05-08T01:12:56Z E. Coli BL21 plys genome Name: recAp +1: 2821841 Sigma Factor: Sigma70 Sigmulon Distance from start of the gene: 50 Sequence: cttgtggcaacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttCaacagaacatattgactatc Evidence(s): [HIPP] Human inference of promoter position [TIM] Transcription initiation mapping Reference(s): [1] Pages V., et al., 2003 false false _801_ 0 9022 9 In stock true the -35 and -10 district, the RBS false Zilong Wang, Yi ZHENG annotation2154312 1 fwd primer range2154312 1 1 17 annotation2154500 1 -35 box range2154500 1 33 38 annotation2154314 1 rev primer range2154314 1 105 124 annotation2154499 1 -10 box range2154499 1 52 60 annotation2154315 1 RBS range2154315 1 106 109 annotation2154313 1 LexA range2154313 1 37 56 BBa_K629001_sequence 1 cagaccttgtggcaacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagaacatattgactatccggtattacccggcatgacaggagtaaaaatggctatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z