BBa_K629002 1 recNp recNp, could be started with exposure to irradiation, UV, nalidixic acid 2011-10-02T11:00:00Z 2015-05-08T01:12:56Z E. Coli BL21 plys genome Name: recNp +1: 2749781 Sigma Factor: Sigma70 Sigmulon Distance from start of the gene: 36 Sequence: aattattctaattttacgccagcctctttactgtatataaaaccagtttatactgtacacAataacagtaatggtttttca -35 -10 +1 Note(s): We assigned a putative transcription start site to this promoter based on the observation that the majority of the promoters, whose transcription start sites were determined experimentally, present a distance of 6 nucleotides between the transcription start site and the -10 box. Evidence(s): [HIPP] Human inference of promoter position Reference(s): [1] Rostas K., et al., 1987 false false _801_ 0 9022 9 It's complicated false the -35 and -10 district, the RBS false Zilong WANG, Yi ZHENG annotation2154339 1 -35 box range2154339 1 58 63 annotation2154340 1 -10 box range2154340 1 77 85 annotation2154344 1 LexA range2154344 1 82 101 annotation2154338 1 fwd primer range2154338 1 1 18 annotation2154341 1 recNp range2154341 1 108 125 annotation2154342 1 RBS range2154342 1 116 119 BBa_K629002_sequence 1 acattaagcaccaagctcggctggtcaaaaaaattattctaattttacgccagcctctttactgtatataaaaccagtttatactgtacacaataacagtaatggtttttcatacaggaaaacgactatgttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z