BBa_K635000 1 BBa_K635000 siRNA gene silencer for use in yeast 2011-09-26T11:00:00Z 2015-05-08T01:12:57Z This part is a novel sequence design. It is complementary to a unique buffer sequence and the kozak sequence (BBa_J63003.) This siRNA fragment is designed for modular inhibition of translation for various synthetic biology systems in yeast. The siRNA is reverse complementary to the biobrick kozak sequence BBa_J63003 and a randomly generated buffer sequence that should precede it GGAGTTGTGGGCACCTGCTA. The idea is similar to the RSID system developed by the Stanford 2010 iGEM team for siRNA control in E.coli. false false _810_ 0 7191 9 It's complicated false The siRNA is intended to be a modular part that can be used in any circuit so long as the gene of interest is preceded by the corresponding random buffer region GGAGTTGTGGGCACCTGCTA and the kozak sequence BBa_J63003. The siRNA therefore was designed to be reverse complementary to the sequence mentioned above. false Arjun Athreya BBa_K635000_sequence 1 ggtggcggcgggtagcaggtgcccacaactcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z