BBa_K635001 1 BBa_K635001 Composite coding region for PDGF-β in yeast 2011-09-26T11:00:00Z 2015-05-08T01:12:57Z The E.coli cDNA sequence was obtained from Sinobiological Inc. The cDNA sequence was codon-optimized for yeast expression. The rest of the sequence contains the biobrick kozak sequence BBa_J63003,the biobrick transcriptional terminator BBa_K392003, a randomly generated buffer region preceding the kozak sequence (GGAGTTGTGGGCACCTGCTA) which is reverse complementary to part of the siRNA sequence (BBa_K635000), and finally a customized poly-A region necessary for expression in yeast. This part contains a platelet derived growth factor (PDGF) sequence modified for effective expression within a yeast chassis. The part contains the cDNA sequence for PDGF codon-optimized for yeast expression. It also contains the biobrick kozak sequence BBa_J63003. Preceding the kozak sequence is a random buffer sequence complementary to an siRNA inhibitor designed for modular inhibition of translation in yeast. The siRNA sequence (BBa_K635000) is reverse complementary to both the kozak sequence and the random buffer. This idea was derived from the 2010 Stanford team's modular siRNA regulation in E.coli. Flanking the cDNA sequence is also a poly-A tail necessary for expression in eukaryotic hosts, such as yeast, to prevent degradation of the mRNA fragment. Following the poly-A tail is the biobrick BBa_K392003 yeast transcriptional terminator. Together these preparatory components allow for expression of PDGF within a yeast chassis. false false _810_ 0 7191 9 Not in stock false The PDGF cDNA sequence could not simply be uploaded to the registry because the gene is not expressible in yeast without the addition of a poly-A region. In addition, the gene was constructed for compatibility with the silencing siRNA (BBa_K635000) if necessary. Therefore a composite part was designed and uploaded to the registry for efficient complete expression of PDGF within the yeast host chassis. false Arjun Athreya annotation2144935 1 Poly A region range2144935 1 624 673 annotation2144934 1 PDGF-beta range2144934 1 33 623 annotation2144933 1 BBa_J63003 (Kozak sequence) range2144933 1 21 32 annotation2144936 1 K392003 (Terminator) range2144936 1 674 802 BBa_K635001_sequence 1 ggagttgtgggcacctgctacccgccgccaccatgagaacttgggcttgtttgttgttgttgggttgtggttatttggctcatgctttggctgaagaagctgaaattccaagagaattgattgaaagattggctagatctcaaattcattctattagagatttgcaaagattgttggaaattgattctgttggtgctgaagatgctttggaaacttctttgagggctcatggttctcatgctattaatcatgttccagaaaaaagaccagttccaattagaagaaaaagatctattgaagaagctattccagctgtttgtaaaactagaactgttatttatgaaattccaagatctcaagttgatccaacttctgctaatttcttgatttggccaccatgtgttgaagttaaaagatgtactggttgttgtaatacttcttctgttaaatgtcaaccatcaagagttcatcatagatctgttaaagttgctaaagttgaatatgttagaaaaaaaccaaaattgaaagaagttcaagttagattggaagaacatttggaatgtgcttgtgctacttctaatttgaatccagatcatagagaagaagaaactgatgttagataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaagcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctattactagagcccgccgccaccatggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z