BBa_K639002 1 BBa_K639002 rrnB P1 promoter 2011-08-25T11:00:00Z 2015-05-08T01:12:57Z BBa_K112118, rrnB P1 promoter BioBrick in BBb format made by the Berkley iGEM team in 2008. rrnB P1 promoter with standard prefix and suffix in BBa format. This is a modified version of the rrnB P1 promoter BioBrick in BBb format made by the Berkley iGEM team in 2008. false false _815_ 0 9667 9 It's complicated true The BioBrick that the Berkeley team made is in BBb format. This means that the BioBrick is flanked by a prefix and a suffix that is different from the ones that are normally used. Therefore, this BioBrick was initially not compatible with the other BioBricks of normal standard (BBa). To deal with this problem, the rrnB P1 promoter was amplified using PCR. The original promoter made by the Berkeley iGEM team was used as template DNA. To make the amplified brick compatible with the rest of our construct, the standard prefix and suffix was added to our primers. false Espen Bang Leistad BBa_K639002_sequence 1 acgtatcctacgcccgtggttaagaatgaaagagccgccagataccgttgtattgggttgcacccatttccctctactacaagaagaactgttacaagtgctgccagagggaacccggctggtggattctggcgcagcgattgctcgccgaacggcctggttgttagaacatgaagccccggatgcaaaatctgccgatgcgaatattgccttttgtatggcaatgacgccaggagctgaacaattattgcccgttttacagcgttacggcttcgaaacgctcgaaaaactggcagttttaggctgatttggttgaatgttgcgcggtcagaaaattattttaaatttcctcttgtcaggccggaataactccctataatgcgccaccactgacacggaacaacggcaaacacgccgccgggtcagcggggttctcctgagaactccggcagagaaagcaaaaataaatgcttgactctgtagcgggaaggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z