BBa_K641003 1 BBa_K641003 {P_rffGH} "stress promoter" 2011-08-30T11:00:00Z 2015-05-08T01:12:58Z The original promoter came from E. Coli genome, but this specific promoter was selected from a library of that promoter. P_rffGH is a promoter used in combination with an rbs for exact expression of ToxR in E.Coli on a pUC plasmid, as to not be toxic to the cell. false false _817_ 0 9470 9 Not in stock false This promoter was selected because of its favorable expression characteristics and its seemingly feedback mechanism of shutting down ToxR production after enough is made. false Spencer Scott BBa_K641003_sequence 1 ctcattaataaactggcaatgaccaagaccaatgacgatttcttcgaaatgatgaaacgctcataaatttgtcttatgccaaaaacgccacgtgtttacgtggcgttttgcttttatatctgtaatcttaatgccgcgctggcgatgttaggaaaattcctggaatttgctggcatgttatgcaatttgcatatcaaatggttaatttttgcacaggactggtgggtttggaacggactttcccttctgaataaaggtcttcgtggttatacttctgctaataattttctctgagagcatgcattgtgaatttactgacagtgagtactgatctcatcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z