BBa_K641005 1 BBa_K641005 ToxR with nhe1 and gly-ser linkers 2011-08-31T11:00:00Z 2015-05-08T01:12:58Z ToxR comes from a virulence island of Vibrio Cholerae. This is the coding sequence for the ToxR protein that has an nhe1 restriction site before a double gly-ser linker that is used to connect many different types of dimerizing proteins to the N-terminal end of ToxR. This sequence will be the same for most ToxR systems unless changing the linker length. ToxR dimerizes when the protein attached to the N-terminus that sits in the periplasm dimerizes with another ToxR-dimerizing construct. false false _817_ 0 9470 9 Not in stock false There had to be a way to exchange N-terminal parts which is why the Nhe1 site is included after the native sequence of ToxR. Another thing to consider is the length of the linker desired in the system. A GSGS linker was used in our system as the preferred length. false Spencer Scott BBa_K641005_sequence 1 atgttcggattaggacacaactcaaaagaaatctcgatgagtcatattggtactaaattcattcttgctgaaaaatttaccttcgatcccctaagcaatactctgattgacaaagaagatagtgaagagatcattcgattaggcagcaacgaaagccgtatcctttggctgctggcccaacgtccaaacgaggtaatttctcgcaatgatttgcatgactttgtttggcgagagcaaggttttgaagtcgatgattccagcttaacccaagccatttcgactctgcgcaaaatgctcaaagattcgacaaagtccccacaatacgtcaaaacggttccgaagcgcggttaccaattgatcgcccgagtggaaacggttgaagaagagatggctcgcgaaaacgaagctgctcatgacatctctcagccggagtccgtcaatgaatacgcagaatcaagcagtgtgccttcatctgctaccgtagtgaacacaccgcagccagccaatgtcgtggcgaataaatcggctccaaacttggggaatcgactgtttattctgatagcggtcttacttcccctcgcagtattactgctcactaacccaagccaatccagctttaaacccctaacgggatctgctagcggaagcggatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z