BBa_K641037 1 BBa_K641037 P(ycgE) - Stress Promoter 2011-09-25T11:00:00Z 2015-05-08T01:12:58Z MG1655 Genomic DNA The promoter is in BglBrick format. It is theorized that this promoter responds to stressful conditions in the cell by down-regulating activity when certain stresses are too high. false false _817_ 0 9508 9 Not in stock false Different stress promoters respond to different intra- and extracellular stress. Therefore it is key to test a variety of stress promoters and see what promoter gives the best stress response. We have put up many stress promoters for others to use and try. false Nikit Patel BBa_K641037_sequence 1 gatctgtttgctaaagctaaattgaatggtatcccttccatagcgtggccagagaaaaaataattttcagcacattctttcacatgatttcagtaaatcatcgtgaaaatgaatacgttacgtttaaatttaatccacattaaaaataatgtttcatccaatttagctgaaatcttatttatactttgtacaattttagcgtatattgtacaaagtattattgggtcgtgtacaggcgacggagatttgtgaccgcaaggaggaattgtggcttattacagcattggtgatgttgctgaacgttgcgggattaatcctgtcactctccgggcctggcaacgccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z