BBa_K643000 1 BBa_K643000 CDS7 cadmium sulfate binding peptide coding sequence 2011-09-24T11:00:00Z 2015-07-21T02:29:26Z This part was synthesized de novo based on the information in the original paper. It was PCR'd out of the synthesized plasmid with RFC 23 overhangs and ligated into pSB1C3 vector. This sequence codes for a short peptide that's been reported to bind to cadmium sulfate and nucleate quantum dot formation. (C. Mi et al. / Journal of Biotechnology 153 (2011) 125???132) Peptide sequence: N-GDVHHHGRHGAEHADI-C false false _819_ 4206 6460 9 It's complicated true Original coding sequence in the referenced paper had NcoI and BamHI sites surrounding the coding sequence for cloning into pET28b IPTG inducible vector. For our purposes we eliminated the restriction sites and instead replaced them with standard biobricking prefix and suffix. false Sung won Lim BBa_K643000_sequence 1 gccatcatcatcatcatcacggcgatgtgcatcatcatggccgccacggcgcggaacatgcggatatttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z