BBa_K643002 1 BBa_K643002 J140 metal binding peptide 2011-09-27T11:00:00Z 2015-07-21T02:29:37Z This protein was selected from a pIII phage display library based on its ability to nucleate ZnS or CdS nanocrystals. J140, with a sequence of Ser-Leu-Thr-Pro-Leu-Thr-Thr-Ser-His-Leu-Arg-Ser, has been shown to recognize single-crystal CdS and nucleate quantum dots (Mao, C., et al. "Viral assembly of oriented quantum dot nanowires" PNAS 100:6946, 2003) false false _819_ 4206 9151 9 It's complicated true We wanted to be able to clone this part into the IPTG-inducible expression vector pET28b, so we engineered in restriction sites that would allow us to do so and keep everything in frame. Therefore the part contains an Nco1 site after the Xba1 site, and a BamH1 site before the Spe1 site. false Rikki Frenkel, Justin Fabrikant BBa_K643002_sequence 1 ccatgggcgttatctctaaccacgcggaatcttctcgtcgtctgtaaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z