BBa_K643004 1 BBa_K643004 Improved version of Bba_K231000 2011-09-27T11:00:00Z 2015-05-08T01:12:58Z Bba_K231000 This is identical in coding sequence to part Bba_K231000 except we wanted to be able to clone this part into the IPTG-inducible expression vector pET28b, so we engineered in restriction sites that would allow us to do so and keep everything in frame. Therefore the part contains an Nco1 site after the Xba1 site, and a BamH1 site before the Spe1 site. false false _819_ 0 9151 9 It's complicated true We wanted to be able to clone this part into the IPTG-inducible expression vector pET28b, so we engineered in restriction sites that would allow us to do so and keep everything in frame. Therefore the part contains an Nco1 site after the Xba1 site, and a BamH1 site before the Spe1 site. false Rikki Frenkel, Justin Fabrikant BBa_K643004_sequence 1 ccatgggctgttgtggttgcggtaaaggtcattgttgtggttgtggtaaaggtcattaaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z