BBa_K648006 1 BBa_K648006 Long 10AA Fusion Protein Linker with Standard 25 Prefix/Suffix 2011-07-02T11:00:00Z 2015-05-08T01:12:59Z Patrick Argos, An investigation of oligopeptides linking domains in protein tertiary structures and possible candidates for general gene fusion, Journal of Molecular Biology, Volume 211, Issue 4, 20 February 1990, Pages 943-958, ISSN 0022-2836, DOI: 10.1016/0022-2836(90)90085-Z. (http://www.sciencedirect.com/science/article/pii/002228369090085Z) Ryoichi Arai,Hiroshi Ueda,Atsushi Kitayama,Noriho Kamiya,and Teruyuki Nagamune. Design of the linkers which effectively separate domains of a bifunctional fusion protein Protein Eng. (2001) 14(8): 529-532 doi:10.1093/protein/14.8.529 This is the longest of the three fusion protein linkers created by the Penn State 2011 iGEM team. It encodes for the ten amino acids GENLYFQSGG and has a prefix and suffix compatible with assembly standard 25. It is used in one of the variants of our Fast-Fusion protein reporter system. false false _825_ 0 9871 9 In stock false This part contains the AgeI and NgoMIV sites as part of it's prefix/suffix that allows it to be used in standard 25 assembly. This part was synthesized through PCR oligo synthesis methods using the following primers: Forward: TATTGAATTCGCGGCCGCTTCTAGATGGCCGGCggtgaaaatttgtattttcaa Reverse: AATACTGCAGCGGCCGCTACTAGTATTAACCGGTaccaccagattgaaaatacaaattttcacc false Jim Rose, Alex Bina, Ben Alouidor, Brian Avison BBa_K648006_sequence 1 ggtgaaaatttgtattttcaatctggtggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z