BBa_K648008 1 BBa_K648008 TEV protease cleaveage site with Standard 25 Prefix/Suffix 2011-07-03T11:00:00Z 2015-05-08T01:12:59Z Phan, J., Zdanov, A., Evdokimov, A. G., Tropea, J. E., Peters, H. P. K., Kapust, R. B., Li, M., Wlodawer, A., and Waugh, D. S. (2002). Structural basis for the substrate specificity of tobacco etch virus protease. J. Biol. Chem. 277: 50564-50572. This is the cleaveage site for th Tobacco etch virus(TEV) protease commonly used for cleaving fusion proteins. It encodes for the amino acids E N L Y F Q G which are cleaved by the TEV protease. This part also contains the prefix/suffix required for standard 25 assembly into fusion parts. false false _825_ 0 9871 9 In stock false This part contains the AgeI and NgoMIV sites as part of it's prefix/suffix that allows it to be used in standard 25 assembly. This part was synthesized through PCR oligo synthesis methods using the following primers: Forward 5'---ATTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGAGAATTTGTATTTTCAGGG---3' Reverse 5'---TAATCTGCAGCGGCCGCTACTAGTATTAACCGGTACCCTGAAAATACAAATTCTC---3' false Jim Rose BBa_K648008_sequence 1 gagaatttgtattttcagggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z