BBa_K648009 1 BBa_K648009 RecA Cleavage Site with Standard 25 Prefix/Suffix 2011-07-03T11:00:00Z 2015-05-08T01:12:59Z Kim, B, and Little, LB. "LexA and lambda Cl repressors as enzymes: specific cleavage in an intermolecular reaction.." Cell 73.6 (1993): 1165-73. Web. 4 Jul 2011. <http://www.ncbi.nlm.nih.gov/pubmed/8513500>. This part encodes for the amino acids V Q A G M F S which are cleavage by the RecA protein within the cell. This sequence was taken from the CI repressor protein which is also cleaved by RecA. false false _825_ 0 9871 9 It's complicated false This part contains the AgeI and NgoMIV sites as part of it's prefix/suffix that allows it to be used in standard 25 assembly. This part was synthesized through PCR oligo synthesis methods using the following primers: Forward Primer 5'---ATTAGAATTCGCGGCCGCTTCTAGATGGCCGGCgttCAGGCAGGGATGTTC---3??? Reverse Primer 5???---TAATCTGCAGCGGCCGCTACTAGTATTAACCGGTtgagaacatccctgcctg ---3??? false Jim Rose BBa_K648009_sequence 1 gttcaggcagggatgttctca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z