BBa_K648011 1 BBa_K648011 Standard 25-Ready Xyle Reporter 2011-07-03T11:00:00Z 2015-05-08T01:12:59Z The original genetic material for this part came from part BBa_K316007 which was mutated via PCR based site-directed mutagensis. The xyle portion of this large part was then amplified via PCR reaction and cloned into a new vector along with a prefix/suffix for standard 25 assembly. This is a mutated version of the Xyle reporter gene which encodes for the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde. This version of Xyle has been made compatible with standard 25 assembly methods by removing three restriction sites (two NgoMIV sites: at bp 315 and 486, as well as one AgeI site: at bp 837). These mutations were made synonymous with the original sequence and codon optimized for E. Coli. Because of the synonymous mutations, this gene can be easily used to create fusion protein parts. For more information on the Xyle gene and its uses as a reporter see part BBa_J33204. false false _825_ 0 9871 9 In stock true The mutations in this gene were made so that they were synonymous and codon optimized for E. coli cells. The part also contains the prefix/suffix for standard 25 assembly with addition restriction sites NgoMIV and AgeI. false Jim Rose annotation2122825 1 misc range2122825 1 1 918 BBa_K648011_sequence 1 aacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccgccgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccagcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccagtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z