BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K648012 1 BBa_K648012 LacZa wtih Standard 25 Prefix/Suffix 2011-07-03T11:00:00Z 2015-05-08T01:12:59Z This part was amplified out of registry stock of LacZa in order to include the standard 25 prefix/suffix This is the lacZa subunit used to complement cells for blue/white screening. It has been cloned into a vector including the prefix/suffix required for standard 25 assembly for fusion proteins. false false _825_ 0 9871 9 Not in stock false This part contains the AgeI and NgoMIV sites as part of it's prefix/suffix that allows it to be used in standard 25 assembly. It was synthesized through PCR oligo synthesis methods using the following primers: Forward TATTGAATTCGCGGCCGCTTCTAGATGGCCGGCACCATGATTACGGATTCAC (57.74 oC) Reverse ATAACTGCAGCGGCCGCTACTAGTATTAACCGGTTCACTCCAGCCAGC (55.05 oC) false Jim Rose annotation2122826 1 protein range2122826 1 1 228 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K648008 1 BBa_K648008 TEV protease cleaveage site with Standard 25 Prefix/Suffix 2011-07-03T11:00:00Z 2015-05-08T01:12:59Z Phan, J., Zdanov, A., Evdokimov, A. G., Tropea, J. E., Peters, H. P. K., Kapust, R. B., Li, M., Wlodawer, A., and Waugh, D. S. (2002). Structural basis for the substrate specificity of tobacco etch virus protease. J. Biol. Chem. 277: 50564-50572. This is the cleaveage site for th Tobacco etch virus(TEV) protease commonly used for cleaving fusion proteins. It encodes for the amino acids E N L Y F Q G which are cleaved by the TEV protease. This part also contains the prefix/suffix required for standard 25 assembly into fusion parts. false false _825_ 0 9871 9 In stock false This part contains the AgeI and NgoMIV sites as part of it's prefix/suffix that allows it to be used in standard 25 assembly. This part was synthesized through PCR oligo synthesis methods using the following primers: Forward 5'---ATTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGAGAATTTGTATTTTCAGGG---3' Reverse 5'---TAATCTGCAGCGGCCGCTACTAGTATTAACCGGTACCCTGAAAATACAAATTCTC---3' false Jim Rose BBa_K648013 1 BBa_K648013 GFP with Standard 25 Prefix/Suffix 2011-07-03T11:00:00Z 2016-01-25T02:32:21Z This part is similar to the part BBa_E0040 commonly used as a reporter. This is the standard GFP protein reporter (E0040) cloned with the prefix/suffix required for standard 25 assembly. It can easily be used to create fusion proteins through this method. false false _825_ 4206 9871 9 In stock false This part contains the AgeI and NgoMIV sites as part of it's prefix/suffix that allows it to be used in standard 25 assembly. It was synthesized through PCR oligo synthesis methods using the following primers: Forward (56.88 degrees) TATTGAATTCGCGGCCGCTTCTAGATGGCCGGCCGTAAAGGAGAAGAACTTTTC Reverse (56.95 degrees) AATACTGCAGCGGCCGCTACTAGTATTAACCGGTCTTGTCGTCATCATCTTTATAAT false Jim Rose annotation2122827 1 misc range2122827 1 1 735 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K648007 1 BBa_K648007 Medium 6AA Fusion Protein Linker: GGSGGS with Standard 25 Prefix/Suffix 2011-07-02T11:00:00Z 2015-05-08T01:12:59Z The inspiration for this part came from the linker used in the 2010 Imperial College London iGEM team GFP-Xyle fusion part: BBa_K316007 Other Sources: Patrick Argos, An investigation of oligopeptides linking domains in protein tertiary structures and possible candidates for general gene fusion, Journal of Molecular Biology, Volume 211, Issue 4, 20 February 1990, Pages 943-958, ISSN 0022-2836, DOI: 10.1016/0022-2836(90)90085-Z. (http://www.sciencedirect.com/science/article/pii/002228369090085Z) Ryoichi Arai,Hiroshi Ueda,Atsushi Kitayama,Noriho Kamiya,and Teruyuki Nagamune. Design of the linkers which effectively separate domains of a bifunctional fusion protein Protein Eng. (2001) 14(8): 529-532 doi:10.1093/protein/14.8.529 This is the mid-sized linker of the three fusion protein linkers created by the Penn State 2011 iGEM team. It encodes for the six amino acids GGSGGS and has a prefix and suffix compatible with assembly standard 25. It is used in one of the variants of our Fast-Fusion protein reporter system. false false _825_ 0 9871 9 Not in stock false This part contains the AgeI and NgoMIV sites as part of it's prefix/suffix that allows it to be used in standard 25 assembly. This part was synthesized through PCR oligo synthesis methods using the following primers: Forward: 5??? TATTGAATTCGCGGCCGCTTCTAGATGGCCGGCggaggttcagg 3??? Reverse: 5???AATACTGCAGCGGCCGCTACTAGTATTAACCGGTgctgcctcctgaacctccGC 3' false Jim Rose BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K648018 1 BBa_K648018 Fast-Fusion GFP-LacZa Reporter (TEV cleavage with Medium linker) 2011-07-04T11:00:00Z 2015-05-08T01:12:59Z The design of this part was inspired by the Imperial College London 2010 iGEM Team's Fast-Response module, part BBa_K316007. This is a fast-acting reporter using the LacZa gene (BBa_K648012) fused to GFP (BBa_K648013). In its normal un-cleaved state the polymerization ability necessary for enzymatic action is inactivated. Once the fusion protein is cleaved by the TEV protease the B-gal enzyme encoded by the LacZa gene is able to convert X-gal to galactose and 5-bromo-4-chloro-3-hydroxyindole, the latter of which is oxidized to the dark blue product 5,5'-dibromo-4,4'-dichloro-indigo. This reporter is able to produce a visible blue color response in a matter of minutes. This version uses the TEV cleavage site (BBa_K648008) followed by the smallest of the three flexible fusion protein linkers (BBa_K648005). The linker is attached to the N-terminus of the LacZa gene. false false _825_ 0 9871 9 Not in stock false All parts were assembled via standard 25 assembly methods. false Jim Rose component2122967 1 BBa_J23100 component2122975 1 BBa_K648012 component2122982 1 BBa_B0015 component2122973 1 BBa_K648007 component2122969 1 BBa_B0034 component2122971 1 BBa_K648013 component2122972 1 BBa_K648008 annotation2122971 1 BBa_K648013 range2122971 1 64 798 annotation2122969 1 BBa_B0034 range2122969 1 44 55 annotation2122967 1 BBa_J23100 range2122967 1 1 35 annotation2122975 1 BBa_K648012 range2122975 1 862 1089 annotation2122982 1 BBa_B0015 range2122982 1 1098 1226 annotation2122972 1 BBa_K648008 range2122972 1 807 827 annotation2122973 1 BBa_K648007 range2122973 1 836 853 BBa_K648012_sequence 1 accatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K648007_sequence 1 ggaggttcaggaggcagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K648008_sequence 1 gagaatttgtattttcagggt BBa_K648013_sequence 1 cgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagattataaagatgatgacgacaag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K648018_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagagcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagattataaagatgatgacgacaagtactagaggagaatttgtattttcagggttactagagggaggttcaggaggcagctactagagaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z