BBa_K648029 1 BBa_K648029 OR, operating region for Lambda switch 2011-07-24T11:00:00Z 2015-05-08T01:12:59Z Galen Lynch notebook, iGEM 2007 Released HQ 2013 The operating region for the Lambda switch that represses C1 and Cro bind to. This region contains promoters prm and pr facing in opposite directions. It also contains operating regions Or3, Or2 and Or1. In the lysogenic state, the C1 dimer is bound naturally bound to the Or1 repressing promotor pr and production of cro. Once RecA cleaves enough C1 dimer the system switches to the lytic state. The Cro produced at the pr promoter then binds to the Or3 site inhibiting the prm promoter. For a better description of the Lambda system read the book "A genetic switch" by Mark Ptashne. We used Or in creation of the lambda system, as part of our project to create a sensor for DNA damage in bacteria due to radiation. false false _825_ 0 9891 9 In stock true false James Coletta, Anisha Katyal, Kristen Salavo, Lauren Rossi BBa_K648029_sequence 1 acgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z