BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J06505 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2015-08-31T04:08:18Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible and with an LVA tag added. Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 0 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends with the LVA tag using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> false ytwang annotation1585879 1 mCherry range1585879 1 1 708 annotation1585880 1 C->T (removing PstI site) range1585880 1 352 352 annotation1585887 1 LVA range1585887 1 709 717 BBa_K648029 1 BBa_K648029 OR, operating region for Lambda switch 2011-07-24T11:00:00Z 2015-05-08T01:12:59Z Galen Lynch notebook, iGEM 2007 Released HQ 2013 The operating region for the Lambda switch that represses C1 and Cro bind to. This region contains promoters prm and pr facing in opposite directions. It also contains operating regions Or3, Or2 and Or1. In the lysogenic state, the C1 dimer is bound naturally bound to the Or1 repressing promotor pr and production of cro. Once RecA cleaves enough C1 dimer the system switches to the lytic state. The Cro produced at the pr promoter then binds to the Or3 site inhibiting the prm promoter. For a better description of the Lambda system read the book "A genetic switch" by Mark Ptashne. We used Or in creation of the lambda system, as part of our project to create a sensor for DNA damage in bacteria due to radiation. false false _825_ 0 9891 9 In stock true false James Coletta, Anisha Katyal, Kristen Salavo, Lauren Rossi BBa_K648030 1 BBa_K648030 Or with RBS B0034 and Mcherry 2011-07-24T11:00:00Z 2015-05-08T01:12:59Z We recieved Mcherry from our graduate student advisor Mike Speer. B0034 was taken from the 2011 registry. Or sequencing was found in Gaylen Lynch's notebook (Penn State iGEM 2007 member) and constructed with primers. The Operating region of the lambda phage switch system with Mcherry on a strong RBS attached after the pr promoter of Or. We used this part in our project to test the pr promoter in Or. Since Mcherry has RFP, one can measure the translation rate of Mcherry. Theoretically you could attach C1 to the prm promoter of Or in order to test its repression and no fluoresence should be observed. false false _825_ 0 9891 9 Not in stock false false James Coletta, Anisha Katyal, Kristen Salavo component2124009 1 BBa_B0034 component2124007 1 BBa_K648029 component2124013 1 BBa_J06505 annotation2124007 1 BBa_K648029 range2124007 1 1 82 annotation2124013 1 BBa_J06505 range2124013 1 109 831 annotation2124009 1 BBa_B0034 range2124009 1 91 102 BBa_B0034_sequence 1 aaagaggagaaa BBa_J06505_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagttagtagcttaataa BBa_K648030_sequence 1 acgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagttagtagcttaataa BBa_K648029_sequence 1 acgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z