BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K648034 1 BBa_K648034 Or tester 2011-09-26T11:00:00Z 2015-05-08T01:12:59Z This part consists of the operating region (Or) for the lambda phage, and also a ribosome binding sight, mcherry with an rfp and a stop codon. false false _825_ 0 7335 9 Not in stock false false Lauren Rossi, Jamie Coletta, Anisha Katyal, Kristen Salava component2145005 1 BBa_K648029 component2145019 1 BBa_K648000 annotation2145005 1 BBa_K648029 range2145005 1 1 82 annotation2145019 1 BBa_K648000 range2145019 1 91 968 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K648029 1 BBa_K648029 OR, operating region for Lambda switch 2011-07-24T11:00:00Z 2015-05-08T01:12:59Z Galen Lynch notebook, iGEM 2007 Released HQ 2013 The operating region for the Lambda switch that represses C1 and Cro bind to. This region contains promoters prm and pr facing in opposite directions. It also contains operating regions Or3, Or2 and Or1. In the lysogenic state, the C1 dimer is bound naturally bound to the Or1 repressing promotor pr and production of cro. Once RecA cleaves enough C1 dimer the system switches to the lytic state. The Cro produced at the pr promoter then binds to the Or3 site inhibiting the prm promoter. For a better description of the Lambda system read the book "A genetic switch" by Mark Ptashne. We used Or in creation of the lambda system, as part of our project to create a sensor for DNA damage in bacteria due to radiation. false false _825_ 0 9891 9 In stock true false James Coletta, Anisha Katyal, Kristen Salavo, Lauren Rossi BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K648000 1 BBa_K648000 mCherry with terminator 2011-05-26T11:00:00Z 2015-05-08T01:12:59Z Parts registry RBS B0034 and truncated mCherry with terminator B0015 attached behind it. mCherry was truncated on the N terminus to remove unnecessary methionine codons. false false _825_ 0 7335 9 It's complicated false the n terminus of mCherry had a sequence which could act as a ribosome binding site near an internal methionine codon which could interfere with the the ribosomes affinity for the actual ribosome binding site. The first 8 amino acids were removed without having any effect on fluorescence. false Lauren Rossi component2120535 1 BBa_B0034 component2120539 1 BBa_J06505 component2120546 1 BBa_B0015 annotation2120546 1 BBa_B0015 range2120546 1 750 878 annotation2120539 1 BBa_J06505 range2120539 1 19 741 annotation2120535 1 BBa_B0034 range2120535 1 1 12 BBa_J06505 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2015-08-31T04:08:18Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible and with an LVA tag added. Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 0 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends with the LVA tag using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> false ytwang annotation1585887 1 LVA range1585887 1 709 717 annotation1585879 1 mCherry range1585879 1 1 708 annotation1585880 1 C->T (removing PstI site) range1585880 1 352 352 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J06505_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagttagtagcttaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K648000_sequence 1 aaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K648029_sequence 1 acgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K648034_sequence 1 acgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z