BBa_K648108 1 BBa_K648108 RecA without restriction sites or recombinant activity 2011-10-22T11:00:00Z 2015-05-08T01:12:59Z The original strain of this part, RecA1, comes from the genomic sequence of the DH10B strain of Escherichia coli RecA is a protein used by E. coli to repair and maintain DNA. Many normal laboratory strains of E. coli, for example DH10B, are mutants capable of an inactivated form of RecA known as RecA1. RecA 1 is deficient in all known function of the RecA gene specifically in ATPase activity, binding with DNA in the presence of ATP, and changing conformation in the presence of ATP and repressor cleavage. In order to restore RecA1 to RecA and to reduce its recombination ability while maintaining its repressor cleavage activity a series of mutations was made. One such mutation occurs at amino acid 160, this adenine residue needed to be mutated to guanine to change RecA1 to RecA and restore its functions. In order to use the standard bio-bricking techniques we also had to remove naturally occurring enzymatic restriction sites. The Pst1 site CTGCAG needed to be converted to CTGCAA. Then the EcoR1 site GAATTC needed to be converted to GAATTT. We also focused on how to mutate RecA so that it would detect damaged DNA without recombining the DNA. After literature research we identified two amino acids in the RecA sequence that were known to affect RecA???s ability to use recombination to repair the DNA. These sites were Arginine 243 and Lysine 286. Research suggested that changing Arginine 243 to Glutamine, and Lysine 286 to Asparagine would remove recombinant activity from RecA. This strain has all five mutations. false false _825_ 0 9869 9 It's complicated false Activate RecA activity from RecA1, remove restriction sites and recombinant activity. false Alex Bina annotation2160313 1 RecA activation mutation range2160313 1 530 530 annotation2160309 1 PstI mutation range2160309 1 237 237 annotation2160312 1 Arg243 mutation range2160312 1 731 731 annotation2160310 1 EcoRI mutation range2160310 1 783 783 annotation2160311 1 Lys286 mutation range2160311 1 861 861 BBa_K648108_sequence 1 atggctatcgacgaaaacaaacagaaagcgttggcggcagcactgggccagattgagaaacaatttggtaaaggctccatcatgcgcctgggtgaagaccgttccatggatgtggaaaccatctctaccggttcgctttcactggatatcgcgcttggggcaggtggtctgccgatgggccgtatcgtcgaaatctacggaccggaatcttccggtaaaaccacgctgacgctgcaagtgatcgccgcagcgcagcgtgaaggtaaaacctgtgcgtttatcgatgctgaacacgcgctggacccaatctacgcacgtaaactgggcgtcgatatcgacaacctgctgtgctcccagccggacaccggcgagcaggcactggaaatctgtgacgccctggcgcgttctggcgcagtagacgttatcgtcgttgactccgtggcggcactgacgccgaaagcggaaatcgaaggcgaaatcgacgactctcacatgggccttgcggcacgtatgatgagccaggcgatgcgtaagctggcgggtaacctgaagcagtccaacacgctgctgatcttcatcaaccagatccgtatgaaaattggtgtgatgttcggtaacccggaaaccactaccggtggtaacgcgctgaaattctacgcctctgttcgtctcgacatccgtcgtatcggcgcggtgaaagagggcgaaaacgtggtgggtagcgaaacccacgtgaaagtggtgaagaacaaaatcgctgcgccgtttaaacaggctgaatttcagatcctctacggcgaaggtatcaacttctacggcgaactggttgacctgggcgtaaaagagaagctgatcgagaacgcaggcgcgtggtacagctacaaaggtgagaagatcggtcagggtaaagcgaatgcgactgcctggctgaaagataacccggaaaccgcgaaagagatcgagaagaaagtacgtgagttgctgctgagcaacccgaactcaacgccggatttctctgtagatgatagcgaaggcgtagcagaaactaacgaagatttttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z