BBa_K649000 1 BBa_K649000 LasR and 3OC12HSL regulated promoter. 2011-09-25T11:00:00Z 2015-05-08T01:13:00Z In the presence of 3OC12HSL lasR can bind to the operator of this promoter and activate the transcription of downstream gene, whereas in the absence of 3OC12HSL lasR can't bind to the operator and can't activate the tarnscription. false false _826_ 0 9681 9 Not in stock false false Tomoyuki Ohno annotation2148165 1 lasI promoter range2148165 1 1 83 BBa_K649000_sequence 1 ttcgagcctagcaagggtccgggttcaccgaaatctatctcatttgctagttataaaattatgaaatttgcgtaaattcttca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z