BBa_K649100 1 BBa_K649100 LsrA promoter 2011-09-22T11:00:00Z 2015-05-08T01:13:00Z PCR LsrA promoter is inhibited by LsrR. In the presense of Phospho-AI2 LsrA promoter works. false false _826_ 0 9687 9 Not in stock false None false Hiroki Yoshise annotation2140180 1 PlsrA range2140180 1 1 98 BBa_K649100_sequence 1 attgtgatctattcgtcggaaatatgtgcaatgtccacctaaggttatgaacaaattaaaagcagaaatacatttgttcaaaactcacctgcaaaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z