BBa_K649401 1 BBa_K649401 Arg box 2011-09-18T11:00:00Z 2015-05-08T01:13:00Z PCR This part contains the Arg Box. The Arg Box is the arg operator capable of binding the arginine repressor. false false _826_ 0 9629 9 In stock true Nothing false Maiko Hayashi annotation2141510 1 ArgBox range2141510 1 17 96 BBa_K649401_sequence 1 aagcggccgcctagagatgctttagacttgcaaatgaataatcatccatataaattgaattttaattcattgaggcgttagccacaggagggatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z