BBa_K649900 1 BBa_K649900 test:AND gate promoter 2011-09-08T11:00:00Z 2015-05-08T01:13:00Z PCR from... XXXX true false _826_ 0 693 76 Discontinued false x false Daisuke Kiga annotation2126891 1 LuxR binding range2126891 1 1 8 annotation2126892 1 -35 range2126892 1 12 17 BBa_K649900_sequence 1 ccgcatcgatcgtacgtagctagcttggcatgctagctagtcatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z