BBa_K649901 1 BBa_K649901 test 2011-09-08T11:00:00Z 2015-05-08T01:13:00Z x x true false _826_ 0 693 76 Discontinued false x false Daisuke Kiga component2126895 1 BBa_K649900 component2126896 1 BBa_R0040 annotation2126896 1 BBa_R0040 range2126896 1 54 107 annotation2126895 1 BBa_K649900 range2126895 1 1 45 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K649900 1 BBa_K649900 test:AND gate promoter 2011-09-08T11:00:00Z 2015-05-08T01:13:00Z PCR from... XXXX true false _826_ 0 693 76 Discontinued false x false Daisuke Kiga annotation2126891 1 LuxR binding range2126891 1 1 8 annotation2126892 1 -35 range2126892 1 12 17 BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K649900_sequence 1 ccgcatcgatcgtacgtagctagcttggcatgctagctagtcatc BBa_K649901_sequence 1 ccgcatcgatcgtacgtagctagcttggcatgctagctagtcatctactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z