BBa_K654030 1 BBa_K654030 Anderson 1.0 Promoter - Promoter only part 2011-09-25T11:00:00Z 2015-05-08T01:13:01Z PCR amplification of existing part fragment Released HQ 2013 The Anderson 1.0 Promoter J23100 in pSB1C3, and not part of a RFP expression unit false false _831_ 0 4660 9 In stock false none false Cole Peterson annotation2141995 1 Anderson 1.0 Promoter J23100 range2141995 1 1 35 annotation2141994 1 -35 box range2141994 1 1 6 annotation2141996 1 -10 box range2141996 1 24 29 BBa_K654030_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z