BBa_K654097 1 BBa_K654097 Anderson 0.10 E. coli Reference Promoter 2011-09-25T11:00:00Z 2015-05-08T01:13:02Z primer annealing Released HQ 2013 This is the Anderson 0.10 E. coli Reference Promoter (BBa_J23114) in pSB1C3 without the RFP expression construct downstream. false false _831_ 0 6788 9 In stock false none false Cody Tramp annotation2142572 1 Anderson 0.10 Promoter J23114 range2142572 1 1 35 annotation2142573 1 -10 box range2142573 1 24 29 annotation2142571 1 -35 box range2142571 1 1 6 BBa_K654097_sequence 1 tttatggctagctcagtcctaggtacaatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z