BBa_K654098 1 BBa_K654098 Anderson 0.01 E. coli Reference Promoter 2011-09-25T11:00:00Z 2015-05-08T01:13:02Z primer annealing Released HQ 2013 This is the Anderson 0.01 E. coli Reference Promoter (BBa_J23103) in pSB1C3 without the RFP expression construct downstream. false false _831_ 0 6788 9 In stock false none false Cody Tramp annotation2142575 1 -10 box range2142575 1 24 29 annotation2142576 1 Anderson 0.01 E. coli Reference Promoter J23103 range2142576 1 1 35 annotation2142574 1 -35 box range2142574 1 1 6 BBa_K654098_sequence 1 ctgatagctagctcagtcctagggattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z