BBa_K656000 1 BBa_K656000 LexA Promoter 2011-05-02T11:00:00Z 2015-05-08T01:13:02Z E. coli genome This is the promoter for the LexA gene. LexA is a repressor protein that prevents transcription of the SOS repair pathway unless DNA damage is detected by binding to the SOS genes' promoters and inactivating them. In the presence of single stranded DNA due to DNA damage, another protein, RecA, interacts with ss-DNA. The RecA-ssDNA complex then interacts with LexA, causing it to cleave off the SOS gene promoter, allowing transcription to go forward. LexA regulates its own promoter false false _833_848_ 0 9303 9 Not in stock false -- false Evan Clark BBa_K656000_sequence 1 cccttccagaattcgataaatctctggtttattgtgcagtttatggttccaaaatcgccttttgctgtatatactcacagcataactgtatatac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z