BBa_K656001 1 BBa_K656001 sulA presequence promotor, rbs, and LexA binding site 2011-06-14T11:00:00Z 2015-05-08T01:13:02Z http://aem.asm.org/cgi/content/abstract/71/5/2338 Norman, Anders, Hestbjerg Hansen, Lars, Sorensen, Soren J. Construction of a ColD cda Promoter-Based SOS-Green Fluorescent Protein Whole-Cell Biosensor with Higher Sensitivity toward Genotoxic Compounds than Constructs Based on recA, umuDC, or sulA Promoters This is the presequence for the sulA gene, which is an damage induced gene (din) that responds to DNA damage. Normally repressed by LexA, in the event of DNA damage, repression is lifted by RecA*-mediated autocleavage of lexA. One of the functions of sulA is to inhibit cell division. false false _833_ 0 9281 9 Not in stock false None. false Lei Ma annotation2120907 1 RBS range2120907 1 50 55 annotation2120906 1 lexA binding site range2120906 1 26 41 annotation2120905 1 -10 range2120905 1 24 25 annotation2120904 1 -35 range2120904 1 1 6 BBa_K656001_sequence 1 ttgatctttgttgtcactggatgtactgtacatccatacagtaactcacaggggctggattgagcatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z