BBa_K658006 1 lux pR-3 position 3 mutated promoter lux pR-3 (luxR & HSL regulated) 2011-09-30T11:00:00Z 2015-05-08T01:13:02Z The position 3 mutated promoter lux pR-3 is based on promoter lux pR (BBa_R0062). The position 3 mutated promoter lux pR-3 is a product of site-directed mutagenesis of promoter lux pR (BBa_R0062). The promoter lux pR is based on the Vibrio fischeri quorum sensing gene promoters. The position 3 mutated promoter lux pR-3 gives a higher expression of downstream genes in an autoinduction system. In another word, the lux pR-3 has a higher efficiency than the lux pR. Similar to promoter lux pR, the expression is up-regulated by the action of LuxR protein combined with the signal molecule HSL. false false _835_ 0 10207 9 Not in stock false In the promoter lux pR's sequence, the C residue of position 3 was changed to a T using PCR method. false Yidan Hu annotation2148161 1 -35 range2148161 1 20 25 annotation2148164 1 K658006 range2148164 1 1 55 annotation2148163 1 start range2148163 1 53 53 annotation2148166 1 LuxR/HSL range2148166 1 1 20 annotation2148162 1 -10 range2148162 1 42 47 BBa_K658006_sequence 1 acttgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z