BBa_K658007 1 lux pR-5 position 5 mutated promoter lux pR-5 (luxR & HSL regulated) 2011-09-30T11:00:00Z 2015-05-08T01:13:02Z The promoter lux pR (BBa_R0062). The position 5 mutated promoter lux pR-5 is a product of site-directed mutagenesis of promoter lux pR (BBa_R0062). The promoter lux pR is based on the Vibrio fischeri quorum sensing gene promoters. The position 5 mutated promoter lux pR-5 gives a higher expression of downstream genes in an autoinduction system. In another word, the lux pR-5 has a higher efficiency than the lux pR. Similar to promoter lux pR, the expression is up-regulated by the action of LuxR protein combined with the signal molecule HSL. false false _835_ 0 10207 9 Not in stock false By PCR method the G residue of position 5 was changed to a C based on the sequence of the promoter lux pR(BBa_R0062). false Yidan Hu annotation2148167 1 start range2148167 1 53 53 annotation2148170 1 -35 range2148170 1 20 25 annotation2148171 1 -10 range2148171 1 42 47 annotation2148168 1 K658007 range2148168 1 1 55 annotation2148169 1 LuxR/HSL range2148169 1 1 20 BBa_K658007_sequence 1 acctctaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z